SubtiBank SubtiBank
recA [2019-03-19 18:49:29]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

recA [2019-03-19 18:49:29]

multifunctional protein involved in homologous recombination and DNA repair ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]-autocleavage), required to internalize and to recombine ssDNA with homologous resident duplex, required for efficient survival and replication restart after replication-transcription conflicts
locus
BSU16940
pI
4.88
mw
37.93 kDa
protein length
348 aa Sequence Blast
gene length
1047 bp Sequence Blast
function
DNA repair/ recombination
product
multifunctional protein involved in homologous recombination and DNA repair ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]-autocleavage)
essential
no
synonyms
recE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,764,645 1,765,691

    Phenotypes of a mutant

  • slower growth [Pubmed|26930481]
  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • reduced [SW|sporulation] efficiency [Pubmed|26930481]
  • strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
  • no amplification of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] chromosomal region to suppress the glutamate auxotrophy of a [gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC] mutant [pubmed|28294562]
  • sensitive to Cr(VI) treatment [pubmed|30745368]
  • The protein

    Catalyzed reaction/ biological activity

  • RecA stimulates ssDNA phosphorylase activity of [protein|64C6D783FF3F41C81B216F798A1DC8071345B1ED|PnpA] [Pubmed|21859751]
  • RecA-ATP in concert with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] catalyzes DNA strand exchange, with [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] as an accessory factor [Pubmed|25138221]
  • RecA-dATP catalyzes strand exchange even in the absence of the accessory factors [Pubmed|25138221]
  • protects sporulating cells from DNA damage [Pubmed|26930481]
  • Protein family

  • recA family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-58 [Pubmed|22517742]
  • phosphorylated on Ser-2 [Pubmed|20509597] by [protein|E86A96B832351FF513DD9853EAD8998CC44C9951|YabT] [Pubmed|23634894]
  • Effectors of protein activity

  • [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] and [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA] provide [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] access to ssDNA during chromosomal transformation [Pubmed|22373918]
  • Structure

  • [PDB|1U94] (RecA from ''E. coli'', 62% identity, 86% similarity)
  • [SW|Localization]

  • colocalizes to the [SW|replisome] in response to endogenous and exogenous DNA damage and in response to damage-independent fork arrest (formation of DNA repair centers), repair center formation depends on [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] and [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR], and is facilitated by [protein|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|RecF] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] [Pubmed|24891441]
  • Nucleoid (Mid-cell) [Pubmed|16479537]
  • localizes to one cell pole [Pubmed|21278288]
  • co-localizes with the DNA uptake machinery [Pubmed|17630974]
  • forms a transient, mobile focus associated with the chromosome during spore development [Pubmed|23634894]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]
    description
    [Pubmed|7690748]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7690748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|8226626,11555642,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|7690748], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • induced by conditions that trigger development of genetic competence ([protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]) [Pubmed|7690748]
  • expression is induced in the presence of Cr(VI) [pubmed|30745368]
  • view in new tab

    Biological materials

    Mutant

  • IRN444 (cat), available in [SW|Jörg Stülke]'s lab
  • GP2542([gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]::spc trpC2), available in [SW|Jörg Stülke]'s lab
  • 1A746 (''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]
  • 1A786 (''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]
  • BP469 (''recA''::''erm''), available in [SW|Fabian Commichau]'s lab
  • BKE16940 (''[gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE16940 ([gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]::erm [gene|search|trpC2]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
  • BKK16940 ([gene|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • labs

  • [SW|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]
  • References

    Reviews

  • 14527291,12045091,10506835,14616075,21517913,23046409,23380520,22933559,17364684
  • Original publications

  • 11814663,16061691,19060143,17803906,16024744,17630974,8226626,11555642,16479537,19730681,7690748,17229847,16267290,20509597,20723756,17449621,21278288,22373918,22517742,23284295,23536821,21859751,23634894,23779106,24285298,24285298,24373815,15378759,24362571,8899710,24670664,24891441,25138221,25169108,25939832,26001966,26786319,26930481,28294562,28344191,28911099,30050509,30254116,30401797,30745368,30814990